Skip to main content

Table 3 Sequence of primers and probes used for digital polymerase chain reaction (ddPCR)

From: A somatic mutation in PIK3CD unravels a novel candidate gene for lymphatic malformation

Primer and probes Sequence (5′-3′)
PIK3CA-F GCTCAAAGCAATTTCTACACGA
PIK3CA-R CTTACCTGTGACTCCATAGAAAATC
PIK3CA-P-G 6-FAM- TGAAATCACTGAGCAGGA- BHQ-X
PIK3CA-P-A HEX- TGAAATCACTAAGCAGG- BHQ-X
PIK3CD-F TCCGAGATGCACGTGCC
PIK3CD-R CCTTCATGTGGTGGGTGCT
PIK3CD-P–T 6-FAM -TTCGGCCTCATCCT- BHQ-X
PIK3CD-P–C HEX -TTCGGCCCCATCC- BHQ-X