Skip to main content

Table 2 Primers for PCR amplication

From: Next generation sequencing identified two novel mutations in NIPBL and a frame shift mutation in CREBBP in three Chinese children

Primer name F, 5′ → 3′ R, 5′ → 3′
NIPBL-EXON20 CATTTTCATTCTAAATGGCAGGT TGACGGTTCAATATAATGGTGGT
NIPBL-EXON3 TTGTTAGGAAGAGGAGGAATGC ATTCTCCCTCGGATATGGAT
CREBBP-EXON8 CTCAGGAGCGATACTAATGAAGCAG CCGAGGACATAGAGTGTGGGAAT