Skip to main content

Table 1 Sequences of primers used for quantitative PCR

From: Possible effects of EXT2 on mesenchymal differentiation - lessons from the zebrafish

Primer name Sequence 5′ → 3′ Lineage Gene structure
adopql qPCR F1 AACCTGGAAGAGATGGCAGA A  
adopql qPCR R1 CAGGAAAGCCTCTTGGTCCT A  
cebpa qPCR F1 CACAACAGCTCCAAGCAAGA A #
cebpa qPCR R1 AATCCATGTAGCCGTTCAGG A #
cebpb qPCR F1 TGTTCAGCCCGGACTTTATG A #
cebpb qPCR R1 AGTCTGGTACGGCAGGTACG A #
col1a2 qPCR F2 CTGGCATGAAGGGACACAG B  
col1a2 qPCR R2 GGGGTTCCATTTGATCCAG B  
col10a1 qPCR F2 CCTGTCTGGCTCATACCACA C  
col10a1 qPCR R2 AAGGCCACCAGGAGAAGAAG C  
osteocalcin qPCR F1 TGAGTGCTGCAGAATCTCCTAA B  
osteocalcin qPCR R1 GTCAGGTCTCCAGGTGCAGT B  
osteopontin qPCR F1 TGAAACAGATGAGAAGGAAGAGG B  
osteopontin qPCR R1 GGGTAGCCCAAACTGTCTCC B  
osterix qPCR F2 GCGTCGATTCTGGAGGAG B  
osterix qPCR R2 AATCTCGGACTGGACTGGTG B  
pparg qPCR F1 GGTTTCATTACGGCGTTCAC A  
pparg qPCR R1 TGCGGCTCTTCTTGTGTATG A  
runx2a qPCR F1 AACTTTCTGTGCTCGGTGCT B, C  
runx2a qPCR R1 GTCATTTCCAGCCATTACCG B, C  
runx2b qPCR F2 CAAACACCCAGACCCTCACT B, C  
runx2b qPCR R2 GTATGACCATGGTGGGGAAG B, C  
scd1 qPCR F1 GTGGCGAAATGTCATTCTGA A  
scd1 qPCR R1 CCATACACGAAACACGCAAA A  
slc25a5 qPCR F1 CCCCCATTGAGAGAGTCAAA HK  
slc25a5 qPCR R1 CCTCTCCAGAACGACAGGAA HK  
sox9a qPCR F1 GGAGCTCAGCAAAACTCTGG C  
sox9a qPCR R1 AGTCGGGGTGATCTTTCTTG C  
srebp1c qPCR F1 CCCCCAGCAGACTCTCTACA A  
srebp1c qPCR R1 CGACAGACTCTGGATCGTCA A  
  1. A, adipocyte-specific gene; B, bone specific gene; C, cartilage specific gene; HK, house keeping gene. #, gene with one exon.
  2. Unless stated otherwise, the primers were designed to construct amplicons of 100–150 bp, spanning at least one intron to avoid amplification from possible genomic DNA contaminant in the template.