Skip to main content

Advertisement

Table 2 Primer sets used for AASS mutation analysis

From: Genetic basis of hyperlysinemia

Amplicon Sequence (5>3)1 Exons Regions of cDNA
A [-21M13]-cgattggcagatgagaaggt 1 (c.–221-c.–16)
[M13-Rev]-atctccaccgcatctcacag
B [-21M13]-cacttgacatcccagttttcc 2 (c.–15-c.210)
[M13-Rev]-ttcctcagctggagtaagca
C [-21M13]-tgttgtgcctttgctacaca 3 (c.211-c.387)
[M13-Rev]-tcccatctgaaaaacaaggtag
D [-21M13]-ttgctacctggcgttttctaa 4 (c.388-c.472)
[M13-Rev]-cttgccgcagaaaagagaaa
E [-21M13]-catgcagattggagaacgag 5 & 6 (c.473-c.687)
[M13-Rev]-atggctgcccacatcatt
F [-21M13]-ggaaggcaagtggagctatg 7 & 8 (c.688-c.894)
[M13-Rev]-tgggcacatgtagacctgaa
G [-21M13]-tttcttcggcatgcaataca 9 (c.895-c.1043)
[M13-Rev]-ctgccaagaggtcaagaaaga
H [-21M13]-gcagagtcctgaagaatgagc 10 & 11 (c.1044-c.1278)
[M13-Rev]-ccccaagagacaagtaagcag
Internal rev seq primer cagcaacccatctcacat
I [-21M13]-gggcagagttgattgcttgt 12 & 13 (c.1279-c.1406)
[M13-Rev]-gccagccacttagtttggat
J [-21M13]-ttgtggaatgcaagattctg 14 & 15 (c.1407-c.1655)
[M13-Rev]-tgatttgtgcaccttctgga
Internal rev seq primer cagaaacaaagtagtcttc
K [-21M13]-gagtgcctgtgtctttttgg 16 & 17 (c.1656-c.1875)
[M13-Rev]-gaacctgggagatggaggtt
Internal forw seq primer ctgagtggatccatggcattg
L [-21M13]-tcaaatggtacatgctttgaaga 18 (c.1876-c.2016)
[M13-Rev]-gggtttgggatcagggagta
M [-21M13]-ttctgttgctttctttgttcg 19 (c.2017-c.2184)
[M13-Rev]-caatcaatcataagattcctgaaaaa
N [-21M13]-gacaggaaaacctgctaggc 20 (c.2185-c.2280)
[M13-Rev]-gactcccatcactgggtcac
O [-21M13]-ttgaggtgtatttgaagttcagtg 21 & 22 (c.2281-c.2485)
[M13-Rev]-acatcttcccattcctgctg
Internal rev seq primer ctacccacattagagcaacg
P [-21M13]-ggcaggaggagatgacagac 23 (c.2486-c.2662)
[M13-Rev]-actcagccaccttggaactg
Q [-21M13]-aaaatgcctaggcctccaag 24 (c.2663-c.*187)
[M13-Rev]-gtggcttgcatctcctgttc
R 5-tctccaagggtcttcaccac-3   c.47-c.66
5-agaatgccaccagctttgac-3   c.236-c.217
S 5-agttcctcaggcagagtcca-3   c.2421-c.2440
5-ggctgaaaagccattgatgt-3   c.2607-c.2588
T 5-gccttccatcccagtttctt-3   c.–116-c.–97
5-ctgcatctctcaccacagga-3   c.1323-c.1342
Internal seq. primer 5-tgcatttttctcccacacaa-3   c.318-c.337
Internal seq. primer 5-cccaaactggagacctcaga-3   c.755-c.774
U 5-gaatgctttggagacatgctt-3   c.1237-c.1257
5-ggtgtattgcctgggaagaa-3   c.*23-c.*42
Internal seq. primer 5-ctgcaagctacatcacaccag-3   c.1724-c.1744
  Internal seq. primer 5-tggcatttcttctgctcaca-3   c.2136-c.2155
  1. 1All forward and reverse primers were tagged with a –21M13 (5-TGTAAAACGACGGCCAGT-3) sequence or M13rev (5-CAGGAAACAGCTATGACC-3) sequence.