Skip to main content

Table 3 Mutated oligonucleotides for site direct mutagenesis

From: Therapy of Fabry disease with pharmacological chaperones: from in silico predictions to in vitro tests

oligo forward reverse
ECOR1_RWARD GCAGAGCTCGTTTAGTGAACCGTCAGAATT  
XHO1_REVERSE   CTGTTCAGGAAACAGCTATGACCGCGGCCG
A230T GCGAAATTTTA CTGACATTGATGATTCCTGG CAATGTCAGT AAAATTTCGCCAGTGATTGC
E341D AAGTGTGGGAT CGACCTCTCTCAGGCTTAGC GAGAGGTCGA TCCCACACTTCAAAGTTGTCTC
L310F AGCCAAAGCTT TCCTTCAGGATAAGGACGTA CCTGAAGGAA AGCTTTGGCTTGAGGGCTGA
V269M GATATGTTAA TGATTGGCAACTTTGGCCTC TTGCCAATCAT TAACATATCTGGGTCATTCC
T410A ATAAATCCCG CAGGCACTGTTTTGCTTCAG ACAGTGCCTGC GGGATTTATGTGACTTCTTA
L300F TCTAATGACT TCCGACACATCAGCCCTCAA GATGTGTCGGAA GTCATTAGACATGAATAAAG
R301P TGACCTCCC ACACATCAGCCCTCAAGCCA GGCTGATGTGTG GGAGGTCATTAGACATGAAT
D244H GTATCTTGC ACTGGACATCTTTTAACCAG GATGTCCAGTG CAAGATACTCTTTATACTTT
Q280K CTGGAATCAGA AAGTAACTCAGATGGCCCTC TGAGTTACTTT CTGATTCCAGCTGAGGCCAA
  1. Underlined bases correspond to the mispairings with the normal alpha-galactosidase sequence used to introduce the mutations in the pCMV6-AC-AGAL vector