Skip to main content

Table 1 Primer sequences used for amplification of exons and exon—intron boundaries of the AIRE gene

From: Molecular and clinical characterization of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome (APECED) in Iranian non-Jewish patients: report of two novel AIRE gene pathogenic variants

Exon Forward primer Reverse primer
1 CTTTGCTCTTTGCGTGGTCG GACTATCCCTGGCTCACAG
2 CCTGGGAGCTCCACCCTCTAGT CACCACTCCGGTTCCAAGTCCA
3 TGGCCAAGGTGTCCAGTTCT TCTAGTACCCAGAGGAGACC
4 GCAAAGGGACTACCCAGCACT TAGGACAGGGTCTCAGAGGGCA
5 GCTGCCTGCTTCTGGCATAGA GGCGTGGTCCTCCTTCCATCT T
6 TCTGCTAGACCCCACCCTG GCCCCCAGCAGAGCCACT
7 GAACAGCGTTGCCTCTGG AGTGCCCAGGTAAAGGCA G
8 GGAGTTCAGGTACCCAGAGA TGACTCAGAACCCCTTTCCA
9 CTGGGGTTTGGGGATCTGTC GGGACATAGTGCTATGGCTGG
10 CCACTCAGTGTGGACGCCTT TGAATTCATCCGCCCCGTAG
11 GTGAGGCTCCTCACTTGCGCCTAG TGTGGTTGTGGGCTGTATGATGTG
12 CACACCCCATACCCCGGA CTGGTGCAAGCCCTCGAAG
13 CCTGCGGCCTCTGTACCC AGAGTGGGGAGCCTGGGTG
14 AGGTTCTCACCGTCACTCTGT ACTGACAAGAGGTGGCGCTGT