Skip to main content

Table 4 Sequence of primers used for quantitative real-time PCR (RT-qPCR)

From: A somatic mutation in PIK3CD unravels a novel candidate gene for lymphatic malformation

Primer Sequence (5′-3′)
GAPDH-F 5ʹ- GGAGCGAGATCCCTCCAAAAT -3ʹ
GAPDH-R 5ʹ- GGCTGTTGT CATACTTCTCATGG -3ʹ
mTOR-F 5ʹ- ATGCTTGGAACCGGACCTG -3ʹ
mTOR-R 5ʹ-TCTTGACTCATCT CTCGGAGTT -3ʹ (reverse)
AKT(Human)-F 5′-CTACCCACACAGCAGTACGC-3'
AKT(Human)-R 5′-AAGTCGCTGGTGTTAAGCCG-3'
S6-F 5ʹ- AGGGTTATGTGGTCCGAATCA -3ʹ
S6-R 5ʹ- TTGGTCTGT AACAGGAATGCC -3ʹ