Genotype-phenotype correlation and description of two novel mutations in Iranian patients with glycogen storage disease 1b (GSD1b)

Table 1 The primers characteristics and the size of PCR products used for Long-range PCR assays

	Name	Sequence	Chromosome Position (GRCh37)	PCR product size
First long-range PCR	F1	AGCATCACTACTGTTACTCCTCAC	Chr11: 118902469–118902492	8276 bp
First long-range PCR	R1	GGAGAATGCTGACCCTGATGAC	Chr11: 118894217–118894238	8276 bp
Second long-range PCR	F1	AGCATCACTACTGTTACTCCTCAC	Chr11: 118902469–118902492	2724 bp
Second long-range PCR	R2	ATGTCCATGGATCTCAGAGCTTC	Chr11: 118899769–118899791	2724 bp

ISSN: 1750-1172