Skip to main content

Table 3 Summary of genetic data and clinical interpretation of novel candidate variants detected in SGCA, SGCB, and SGCG according to the 2015 ACMG-AMP guidelines [19]

From: Clinical and genetic spectrum of sarcoglycanopathies in a large cohort of Chinese patients

Patients Gene c.DNA position Exon Effect on protein Type of variants Location of mutation allele Parental derivation Variants pathogenicity Evidence of pathogenicity
P1 SGCA c.101G > Aa Exon 2 p.R34H Missense Extracellular Maternal Pathogenic  
  SGCA c.218C > Gb Exon 3 p.P73R Missense Extracellular Paternal Likely pathogenic PM1, PM2, PM3, PP1, PP3, PP4
  PMP22 Exons 1–5 duplicationa Exons 1–5 Large duplication NA Pathogenic  
P2 SGCA c.158-10_160delb Intron 2, Exon 3 Splicing# Extracellular Maternal Likely pathogenic PM2, PM3, PP1, PP3, PP4
  SGCA c.662G > Aa Exon 6 p.R221H Missense Extracellular Paternal Pathogenic  
P3 SGCA c.662G > Aa Exon 6 p.R221H Missense Extracellular NA Pathogenic  
P4 SGCA c.313-2A > Ga Intron 3 NA Splicing Extracellular Maternal Pathogenic  
  SGCA c.95 T > Ca Exon 2 p.V32A Missense Extracellular Paternal Pathogenic  
P5 SGCA c.424A > Ga Exon 5 p.S142G Missense Extracellular NA Pathogenic  
P6 SGCA c.889delCa Exon 7 p.L298Cfs*23 Frameshift TM Maternal Pathogenic  
  SGCA c.292C > Ta Exon 3 p.R98C Missense Extracellular Paternal Pathogenic  
P7 SGCA c.409G > Ca Exon 5 p.E137Q Missense Extracellular Maternal Pathogenic  
  SGCA c.95 T > Ca Exon 2 p.V32A Missense Extracellular Paternal Pathogenic  
P8 SGCA c.661C > Ta Exon 6 p.R221C Missense Extracellular Maternal Pathogenic  
  SGCA c.320C > Ta Exon 4 p.A107V Missense Extracellular Paternal Pathogenic  
P9 SGCA c.233_234delinsGAa Exon 3 p.Y78* Nonsense Extracellular Maternal Pathogenic  
  SGCA c.371 T > Ca Exon 4 p.I124T Missense Extracellular Paternal Pathogenic  
P10 SGCA Exons 1–7 duplicationb Exons 1–7 Large duplication Singal peptide + Extracellular + TM + Intracellular Maternal Pathogenic PVS1, PM3, PP1, PP4
  SGCA c.229C > Ta Exon 3 p.R77C Missense Extracellular Paternal Pathogenic  
P11 SGCA Exons 4–8 deletionb Exons 4–8 Large deletion Extracellular + TM + Intracellular Maternal Pathogenic PVS1, PM3, PP1, PP4
  SGCA c.234C > Ab Exon 3 p.Y78* Nonsense Extracellular Paternal Pathogenic PVS1, PM2, PP4
P12 SGCA c.956 + 2 T > Ca Intron 7 Splicing Intracellular Maternal Pathogenic  
  SGCA c.662G > Aa Exon 6 p.R221H Missense Extracellular Paternal Pathogenic  
P13 SGCA c.427C > Tb Exon 5 p.H143Y Missense Extracellular Maternal Likely pathogenic PM2, PM3, PP1, PP3, PP4
  SGCA c.229C > Ta Exon 3 p.R77C Missense Extracellular Paternal Pathogenic  
P14 SGCA c.662G > Aa Exon 6 p.R221H Missense Extracellular Maternal Pathogenic  
  SGCA c.956G > Ab Exon 7 p.R319K Missense Intracellular Paternal Likely pathogenic PM2, PM3, PP1, PP4
P15 SGCA Exons 7–8 deletiona Exons 7–8 Large deletion TM + Intracellular Maternal Pathogenic  
  SGCA c.218C > Tb Exon 3 p.P73L Missense Extracellular Paternal Likely pathogenic PM1, PM2, PM3, PP1, PP3, PP4
P16 SGCA c.1A > Gb (hom) Exon 1 p.0? Init-loss Singal peptide Maternal/Paternal Pathogenic PVS1, PM2, PP1, PP3, PP4
P17 SGCA c.662G > Aa Exon 6 p.R221H Missense Extracellular Maternal Pathogenic  
  SGCA c.95 T > Ca Exon 2 p.V32A Missense Extracellular Paternal Pathogenic  
P18 SGCA c.409G > Aa Exon 5 p.E137K Missense Extracellular Maternal Pathogenic  
  SGCA c.687delTb Exon 6 p.L230Cfs*18 Frameshift Extracellular Paternal Pathogenic PVS1, PM2, PM3, PP1, PP4
P19 SGCB c.551A > Ga Exon 4 p.Y184C Missense Extracellular Maternal Pathogenic  
  SGCB Exons 5–6 deletionb Exons 5–6 Large deletion Extracellular Paternal Pathogenic PVS1, PM3, PP1, PP4
P20 SGCB c.334C > Ta Exon 3 p.Q112* Nonsense Extracellular Paternal Pathogenic  
P21 SGCB c.29_33delAACAGb (hom) Exon 1 p.E10Afs*13 Frameshift Intracellular Maternal/Paternal Pathogenic PVS1, PM2, PP1, PP4
P22 SGCB c.273_292delb (hom) Exon 3 p.I92* Frameshift TM NA Pathogenic PVS1, PM2, PP4
P23 SGCB c.29_33delAACAGb Exon 1 p.E10Afs*13 Frameshift Intracellular Maternal Pathogenic PVS1, PM2, PP1, PP4
  SGCB c.366_367delTTb Exon 3 p.Y123* Frameshift Extracellular Paternal Pathogenic PVS1, PM2, PP1, PP4
P24 SGCB c.543C > Ab Exon 4 p.S181R Missense Extracellular Maternal Likely pathogenic PS1, PM2, PP3, PP4
P25 SGCG c.320C > Tb (hom) Exon 4 p.S107 L Missense Extracellular Maternal/Paternal Likely pathogenic PM2, PM3, PP1, PP3, PP4
  1. a, The variants have been previously reported as pathogenic [2, 13, 33,34,35,36,37,38,39,40,41,42]; b, novel variants; #, This mutation most likely affects splicing because it can cause loss of the acceptor splice sites, as confirmed by HSF Matrices and MaxEnt algorithms [30]. Init-loss, initiation codon loss; hom, homozygous; NA not available, TM transmembrane, PVS pathogenic very strong, PS pathogenic strong, PM pathogenic moderate, PP pathogenic supporting; c.158-10_160del, c.158-10_160delCTTCCACCAGCTG; c.273_292del, c.273_292delCATTGGACCAAATGGCTGTG