Skip to main content

Table 2 Allele frequencies in various population databases and in silico analysis of novel candidate variants detected in SGCA, SGCB, and SGCG

From: Clinical and genetic spectrum of sarcoglycanopathies in a large cohort of Chinese patients

Gene c.DNA position Global AF in all subpopulation FATHMM Mutation Taster PolyPhen-2 HumVar SIFT GERP*
gnomAD ESP6500 TGP ExAC 100 HC
SGCA c.218C > G absent absent absent absent absent Deleterious Disease_causing Probably damaging Deleterious 4.53
SGCA c.218C > T 0.00000815 absent absent absent absent Deleterious Disease_causing Probably damaging Deleterious 4.53
SGCA c.158-10_160del absent absent absent absent absent
SGCA c.234C > A absent absent absent absent absent Deleterious −1.04
SGCA c.427C > T absent absent absent absent absent Deleterious Disease_causing Possibly damaging Tolerated 4.35
SGCA c.956G > A absent absent absent absent absent Deleterious Disease_causing Benign Tolerated 1.19
SGCA c.1A > G absent absent absent absent absent Deleterious Disease_causing Possibly damaging Deleterious 3.78
SGCA c.687delT absent absent absent absent absent
SGCA Exons 1–7 duplication
SGCA Exons 4–8 deletion
SGCB Exons 5–6 deletion
SGCB c.29_33delAACAG absent absent absent absent absent
SGCB c.273_292del absent absent absent absent absent
SGCB c.366_367delTT absent absent absent absent absent
SGCB c.543C > A absent absent absent absent absent Deleterious Disease_causing Probably damaging Deleterious 3.3
SGCG c.320C > T 0.00000813 absent absent 0.000008 absent Deleterious Disease_causing Probably damaging Deleterious 5.39
  1. c.158-10_160del, c.158-10_160delCTTCCACCAGCTG; c.273_292del, c.273_292delCATTGGACCAAATGGCTGTG; *, The cutoff was set to 2.0 for GERP (smaller scores indicating less conservation) [24]. AF, allele frequency; gnomAD, Genome Aggregation Database; ESP6500, NHLBI Exome Sequencing Project (ESP6500) Exome Variant Server; TGP, 1000 Genomes Project; ExAC, Exome Aggregation Consortium Browser; 100 HC, 100 healthy control subjects of Chinese origin