Fig. 2
From: Clinical and genetic spectrum of sarcoglycanopathies in a large cohort of Chinese patients
Spectrum and location of mutations in SGCA, SGCB, and SGCG. SGCA, SGCB, and SGCG were represented by their exons. To accommodate the distribution of mutations, the size of the exons was not represented at scale. To illustrate the reading frame, the exons are schematically represented by boxes with blunt, protrusive or intrusive ends. Nucleotide numbering for all mutations was designated according to the coding DNA reference sequence (CDS) in GenBank Accession number NM_000023.2 (SGCA), NM_000232.4 (SGCB), and NM_000231.2(SGCG). Information for the different protein domains is available in https://www.uniprot.org/. Numerals within parentheses indicate, for each mutation, the number of patients harboring the mutation. c.158-10_160del, c.158-10_160delCTTCCACCAGCTG; c.273_292del, c.273_292delCATTGGACCAAATGGCTGTG