Skip to main content

Table 1 Primers used for qPCR amplications

From: Repurposing propranolol as a drug for the treatment of retinal haemangioblastomas in von Hippel-Lindau disease

GENE Forward Reverse
18S 5′- CTCAACACGGGAAACCTCAC - 3′ 5′-CGCTCCACCAACTAAGAACG - 3′.
BAX 5′- CACTCCCGCCACAAAGAT - 3′ 5′- CAAGACCAGGGTGGTTGG - 3′
EPO 5′ - TGTTTTCGCACCTACCATCA - 3′ 5′ - AAGTCACAGCTTGCCACCT - 3′
SOX2 5′ – GGGGGAATGGACCTTGTATAG - 3′ 5′ – CGCTCCACCAACTAAGAACG - 3′
OCT4 5′- CTTCGGATTTCGTCTTCTCG-3′ 5′- CTTAGCCAGGTCCGAGGAT - 3′