Skip to main content

Table 1 Sequences of Primers Used for PCR amplification and Sequencing of GNPTAB

From: Clinical, biochemical and molecular characterization of Korean patients with mucolipidosis II/III and successful prenatal diagnosis

Exon Primers
1 F: ctatgcccctccgtcctc
R: gctcaggagttcgagaccag
2 F: ttgtccttttcaggaactgtagc
R: cacaggggccacactaatct
3 F: cccccagctacagtttgaa
R: acctccacctcccaaagttc
4 F: ggccaccttatattggagca
R: actctaaccctccccagtgc
5 F: tccatgagataaaagtcttcatttg
R: gcagctgttttgcttctcttt
6 F: tcccatgaagaattcccttt
R: gcatcacaacacaagcttcaa
7 F: gctgtttttctttgagaatcttttt
R: aaggagtgaggctcttctgg
8 F: ggaggttgaggtgagcagag
R: taccaaaccaatggcagtga
9 F: aatgctgtctctttgaattttgg
R: gagagctgtttgggtttggt
10 F: ccctttacccttctacctcca
R: tatgcttcccaagctggtct
11 F: tcaacgcagcaggatctaaa
R: actcctcccagctcagcttt
12 F: tgatccagcctcctctgc
R: cctcttcagtgatttatgttgttctc
13_1 F: cacaaggacgacatgcaaat
R: cgtaacccttctgggctgta
13_2 F: tgatccttctcccaaaccag
R: tgatctcagcaaggctgact
13_3 F: aggcggaaatcctttttgag
R: aatcagagatgggggctttt
13_4 F: gctccacaggaaaaacaggt
R: aaatgaaaccatgtaagaaaagca
14 F: tgacccgttaacatgtatttca
R: catttgcagagatggacttttt
15 F: tgctcgtgtttgagttgtttg
R: ggttggtctcgaactcctga
16 F: ttggcattgtctcattctgc
R: ttacgcatctatggggtgaa
17 F: ggtttggtttgtgaaaaatgc
R: ccgtagtggactcaacatcca
18 F: aatcacaaaggtctggcttttt
R: atgggggaccctatctcaac
19 F: tcattcccccagagaatcat
R: aggttgcagtgagctgaggt
20 F: cctctctcctgcctggataa
R: tgctgcctgaatattgtgaaa
21 F: ttttggaagaggaatgatgga
R: aggatgacaggtccatgagc