Skip to main content

Table 2 Real-time PCR primer sequences

From: Skin fibroblasts from individuals with Chediak-Higashi Syndrome (CHS) exhibit hyposensitive immunogenic response

Gene Accession Prime forward Prime reverse
IL-1β NM_000576.2 TACCTGTCCTGCGTGTGAA TCTTTGGGTAATTTTTGGGATCT
IL-6 NM_000600.3 GATGAGTACAAAAGTCCTGATCCA CTGCAGCCACTGGTTCTGT
COX-2 NM_000963.2 CTTCACGCATCAGTTTTTCAAG TCACCGTAAATATGATTTAAGTCCAC
TLR-2 NM_003264.3 CGTTCTCTCAGGTGACTGCTC CCTTTGGATCCTGCTTGC
TLR-3 NM_003265.2 AGAGTTGTCATCGAATCAAATTAAAG AATCTTCCAATTGCGTAAAA
TLR-4 NM_138557.2 CCTGCGTGAGACCAGAAAG TTCAGCTCCATGCATTGATAA
GAPDH NM_002046.4 AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC