Skip to main content

Table 1 Oligonucleotides used for TAZ gene mutation analysis

From: New clinical and molecular insights on Barth syndrome

Fragment name Primer Sequence 5’-3’ Included exons Amplified gene region* Length (bp)
Taz 1-2 Taz 1-2fw agtcaggggccagtgtctc 1 and 2 g.5224_5736 552
Taz 1-2rv gaaggggtttgttctgacga
Taz 3-4 Taz 3-4fw ctggggatatgggaagttgg 3 and 4 g.6642_7095 494
Taz 3-4rv ccataggtccctccaaaaca
Taz 5 Taz 5fw aaggtcatggggtaggaggt 5 g.7519_7714 236
Taz 5rv aaactcctgggcttgagtga
Taz 6-7 Taz 6-7fw ccccgagaatggttactgat 6 and 7 g.12983_13340 398
Taz 6-7rv aggcctagtctcagcacctg
Taz 8-9 Taz 8-9fw gggagctgaattgaactgga 8 and 9 g.13404_13753 390
Taz 8-9rv agacagcagacaggcagaca
Taz 10-11 Taz 10-11fw ggcactcctactgctcctca 10 and 11 g.14097_14513 457
Taz 10-11rv agcatcagtccatccctcag
  1. *based upon the reference nucleotide sequence NG_009634.1. Positions do not include the primer sequences.