Skip to main content

Table 1 PPOX probe mix

From: Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

Probe name Sizea 5half hyb sequenceb 3half hyb sequencec SD N1 N2 Fam A Fam E
GABRA4d 84 CAGCCTGTTGTCATAACCATCG AGCAAACTGTCCAGGATGCG 0.20 nd nd nd nd
RELNe 87 CAGCATTACGGAATGAAGGTCA CCACAAGAAGTGGCTTCACAACC 0.04 1.02 0.99 0.98 0.96
PPOXex1 90 GGGAGTAGCGGATTTGAAGCACTT GTTGGCCTACAGAGGTGTGGCAAG 0.03 0.94 1.00 1.07 1.01
PPOXex7v3 93 CTGAGCGCTGGAGCCAGTGGTCACTT CGTGGAGGTCTAGAGATGTTGCCTC 0.04 1.00 0.99 1.03 0.55
PPOXex5v5 96 GCAAAGAGCCTGATGAGACTGTGC ACAGTTTTGCCCAGCGCCGCCTTGGACCTG 0.03 1.04 1.00 0.57 0.60
PPOXex6 99 GTGTTTGCAGGCAACAGCCGTGAGCTCA GCATCAGGTCCTGCTTTCCCAGTCTCTTC 0.03 1.02 1.02 0.59 0.58
PPOXex3 102 GCTCCGTTCGAGGCCCTAATGGTGCTATCT TTGAGCTTGGACCTCGGGGAATTAGGCCAG 0.02 1.00 0.93 1.04 1.11
CLDN16e 105 GACACAAGGGTGTAAAATGCACG TTTCAGGGTGTGTTTGCATATGATTTAATCAATCAGTATG 0.04 1.00 1.02 1.01 1.00
PPOXex9 108 GTGCCATCACTGCAGTGTCTGTAGCTGTGGTGA ATCTGCAGTACCAAGGAGCCCATCTGCCTGTCC 0.03 1.05 0.99 1.02 0.58
PPOXex11 111 CTGTTTCAACAGCGGGCCCAGGAAGCAGCTGCTA CACAATTAGGACTGAAGGAGATGCCGAGCCACTGC 0.03 1.04 1.04 0.99 1.22
PPOXex4 114 CATGCCCTACCCACTGGCCTCAGGTAACACCAGCA CCTCCGCTCCTTTTACTGTGCCCTCATCCTCATATGC 0.02 1.05 1.03 1.06 1.16
PPOXex8 117 CTCATTTTCTGGGTCTCTCAAATGTTTTCATGCTCTC AGGTATCTCTAAGGGACAGCAGTCTGGAGGCTGACCAC 0.04 1.06 1.03 0.98 0.56
PPOXex12 120 CTGGCAAAAACTAGGTAAGTTGGGAAAACAGCTGGGCT GAGGAGGGCCAAGGACATCAGACCCCCAGCTAAAACATTC 0.03 1.06 1.09 0.99 1.16
PPOXex10 123 CTGACGCATGAATGTCCTTCTCTCCAGGGATTTGGACATT TGGTGCCATCTTCAGAAGATCCAGGAGTCCTGGGAATCGTG 0.03 1.06 1.09 0.93 1.16
PPOXex13 126 GCTGTTAATGACTGTATAGAGAGTGGGCGCCAGGCAGCAGTCA GTGTCCTGGGCACAGAACCTAACAGCTGATCCCCAACTCTC 0.03 1.08 1.03 1.04 1.13
RB1ex23e 129 GTCACCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCT AGTTCACCCTTACGGATTCCTGGAGGGAACATCTATATTTCACC 0.02 1.00 1.02 0.98 1.11
PPOXex2v4 132 CCTAAGGTGAGTGCTCCACTTGTGCCAGAGGGAGCTTCATTTAATGC TCTTCCCATTTCCATCAAAAGCTAGATGGATCCTGGCCCTCTG 0.02 1.01 1.00 1.09 1.08
SRY 135 CAGTGCAAAGGAAGGAAGAGCTTCTCCGGAGAGCGGGAATATTCT CTTGCACAGCTGGACTGTAATCATCGCTGTTGAATACGCTTAACATAG nd nd nd nd nd
  1. aSize of the ligaton product in bp.
  2. bThe 5 half-probes are preceded by the universal tag sequence GGGTTCCCTAAGGGTTGGA.
  3. cThe 3 half-probes are followed by the universal tag sequence CTAGATTGGATCTTGCTGGCAC and are phosphorylated at the 5 end.
  4. dPilot probe.
  5. eReference probes.
  6. SD standard deviation.
  7. Nd not determined.