Skip to main content

Table 1 ISH probes used in this study

From: A core microbiome associated with the peritoneal tumors of pseudomyxoma peritonei

Probe (Abbreviation) Taxonomic depth Sequence (5’-3’) Target
Actinobacteria (ACT) Phylum TATAGTTACCACCGCCGT 23S rRNA
Bacteroidetes (BAC) Phylum AGCTGCCTTCGCAATCGG 16S rRNA
Firmicutes (FIR) Phylum TGGAAGATTCCCTACTGC 16S rRNA
Betaproteobacteria (BET) Class CCCATTGTCCAAAATTCCCC 16S rRNA
Gammaproteobacteria (GAM) Class GCCTTCCCACATCGTTT 16S rRNA
Rhizobiales (RHI) Order TCGCTGCCCACTGTCACC 16S rRNA
Verrucomicrobiales (VER) Order GCTGCCACCCGTAGGTGT 16S rRNA
Pseudomonas (PSE) Genus TCTGGAAAGTTCTCAGCA 16S rRNA
Propionibacterium (PRO) Genus CACCCATCTCTGAGCACCCCG 16S rRNA
Streptococcus (STR) Genus CCACTCTCCCCTTCTGCAC 16S rRNA