Figure 2
From: Congenital Dyserythropoietic Anemia Type II: molecular analysis and expression of the SEC23B Gene
Characterization of SEC23B mutations in patient A4. Lymphocytic cDNA was amplified using primers localized in exons 1 and 4 (A4-SEC23B-1F: TTGTACCCCTGGCTTGTCTC and A4-SEC23B-4R: ATGAACCTGCACCATCCTTC). The control shows the 425-bp product (wild-type, W.T.); (1) Patient A4: Two bands (456-bp and 425-bp) were present. The additional 456-bp band is due to the splicing mutation: c.221+31 A > G; (2) The nonsense mutation (c.367 C > T) creates a restriction site for the enzyme HpyCH4III. SEC23B PCR product from patient A4 was enzymatically digested. The two resulting bands (262-bp and 163-bp) represent the cut allele carrying the nonsense mutation. M.W. = Molecular Weight.