Skip to main content

Table 1 Non-deletional mutations that cause α-thalassaemia

From: α-thalassaemia

Affected sequence Affected gene * Mutation(s) HGVS Synonym Hb- name Distribution Phenotype
mRNA processing
Cryptic splicing α2 Cd22 C>T c.69C>T p.Gly23Gly   Surinamese α+
IVS(donor) α2 IVS I(-5 nt) c.95+2_95+6delTGAGG   Mediterranean α+
  α1 IVS I-1(g>a) c.95+1G>A   Thai α+
  α2 IVS II-2 (t>a) c.300+2T>A   North-European α+ - α0
IVS(acceptor) α2 IVS I-116 (a>g) c.96-2A>G   Dutch α+
  α1 IVS I-117 (g>a) c.96-1G>A   Asian Indian α+
  α2 IVS II-142 (g>a) c.301-1G>A   Argentinian α+ - α0
  α1 IVS II-148 (a>g) c.301-2A>G   Iranian α+
Poly A signal α2 PA del 16 bp c.*74_*89delCCTTCCTGGTCTTTGA   Arab α+ - α0
  α2 PA1 (AATAAG) c.*94A>G   Middle East, Med α+ - α0
  α2 PA2 (AATGAA) c.*92A>G   Med, Chinese α+ - α0
  α2 PA3 (AATA- -) c.*93_*94delAA   Asian Indian α+ - α0
  α2 PA4 (AATAAC) c.*94A>C    α+ - α0
mRNA translation
Initiation codon - α3.7 init ATG>GTG c.1A>G p.Met1Val   African α0
  - α3.7 II init (-2 bp) c.-2_-3delAC   N-African, Med α+ - α0
  α2 init ATG>ACG c.2T>C p.Met1Thr   Med α+
  α2 init ATG>A-G c.2delT p.Met1fs   Vietnam α+
  α1 init ATG>GTG c.1A>G p.Met1Val   Med α+
  α2 init ATG>-TG c.1delA p.Met1fs   South-East Asian α+
Exon I α1 Cd14 G>A c.44G>A p.Trp15X   Iranian α0
  α2 Cd19 (-G) c.60delG p.His21fs   Iranian α+
  α2 Cd22 (-C) c.69delC p.Gly23fs   African  
  α2 Cd23 (G>T) c.70G>T p.Glu24X   Tunesian α0
  - α Cd30/31(-2 bp) c.94_95delAG   African α0
Exon II α2 Cd39/41(del/ins) c.118_126delACCAAGACC dup TACTTCCC p.Thr40fs   Yemenite-Jewish α+
  α1 Cd51-55(-13 bp) c.155_167delGCTCTGCCCAGGT p.Gly52fs   Spanish α+
  α1 Cd62(-G) c.187delG p.Val63fs   African  
  α1 Cd78(-C) c.237delC p.Asn79fs   Black/Chinese  
  α2 Cd90 A>T c.271A>T p.Lys91X   Middle Eastern α+
Exon III α1 Cd108(-C) c.326delC p.Thr109fs   Jewish α+ - α0
  α2 Cd113/114(-C) c.342_343delC p.Leu114fs   Unknown  
  α2 Cd113-116(-12 bp) c.[339C>G;340_351delCTCCCCGCCGAG] Leida Spanish α+ - α0
  α2 Cd116 G>T c.349G>T p.Glu117X   African α+
  α1 Cd131(+T) c.396_397insT Pak Num Po Thai α0
Termination codon α2 Term Cd TAA>CAA c.427T>C p.X143Gln Constant Spring South-East Asian α+
  α2 Term Cd TAA>AAA c.427T>A p.X143Lys Icaria Med α+
  α2 Term Cd TAA>TCA c.428A>C p.X143Ser Koya Dora Indian α+
  α2 Term Cd TAA>GAA c.427T>G p.X143Glu Seal Rock African α+
  α2 Term Cd TAA>TAT c.429A>T p.X143Leu Paksé Laotian, Thai α+
Post translational
Exon I - α Cd14 T>G c.43T>G p.Trp15Gly Evanston African α+
  α2 Cd21 G>T c.64G>T p.Ala22Ser Zoetermeer Dutch α+
  α2 Cd21 G>C c.64G>C p.Ala22Pro Fontaine-bleau French α+
  α2 Cd29 T>C c.89T>C p.Leu30Pro Agrinio Med α+
  α2 Cd30(-3 bp) c.91_93delGAG p.Glu31del   Chinese α+ - α0
  α2 Cd31 G>A c.95G>A   Chinese α+ - α0
Exon II α2 Cd32 G>A c.99G>A p.Met33Ile Amsterdam Surinamese black α+ - α0
  α2 Cd33 T>C c.101T>C p.Phe34Ser Chartres French α+
  α2 Cd35 T>C c.106T>C p.Ser36Pro Evora Filipino, Portugese α+ - α0
  α1 Cd37(-3 bp) c.112_114delCCC Heraklion Greece α+ - α0
  α2 Cd59 G>A c.179G>A p.Gly60Asp Adana Chinese α+ - α0
  α1 Cd60/61(-3 bp) c.184_186delAAG Clinic Spanish α+ - α0
  α2 Cd62(-3 bp) c.187_189delGTG Aghia Sophia Greek α0
  α1 Cd64-74(-33 bp) c.196_228delGCGCTGACCAAGGCCGTGGCGCACGTGGAC   Greek α0
  α2 Cd66 T>C c.200T>C p.Leu67Pro Dartmouth Caucasian α+ - α0
  α2 Cd93 T>G c.281T>G p.Val94Gly Bronte Italian α+
  α1 Cd93-99(dup21 bp) c.280_300dupGTGGACCCGGTCAACTTCAAG   Iranian α+ - α0
Exon III α2 Cd103 A>T c.311A>T p.His104Leu Bronovo Turkish α+
  α2 Cd104 G>A c.314G>A Cys105Tyr Sallanches French/Pakistani α+
  α1 Cd104 T>A c.313T>A p.Cys105Ser Oegstgeest Surinamese α+
  α2 Cd108 C>A c.326C>A p.Thr109Asn Bleuland Surinamese α+
  α2 Cd109 T>G c.329T>G p.Leu110Arg Suan Dok Thai α+
  α Cd110 C>A c.332C>A Ala111Asp Petah Tikva Middle East α+
  α1 Cd119 C>T c.358C>T p.Pro120Ser Groene Hart or Bernalda Moroccan α+
  α2 Cd125 T>G c.377T>G p.Leu126Arg Plasencia Spanish α+
  α2 Cd125 T>C c.377T>C p.Leu126Pro Quong Sze Chinese α+
  - α3.7 Cd125 T>A c.377T>A p.Leu126Gln Westeinde Jewish α0
  α1 Cd129 T>C c.389T>C p.Leu130Pro Tunis-Bizerte Tunisian α+
  α2 Cd129 T>C c.389T>C p.Leu130Pro Utrecht Dutch α+
  α2 Cd130 G>C c.391G>C p.Ala131Pro Sun Prairie Asian Indian α+
  α2 Cd131 T>C c.394T>C p.Ser132Pro Questembert French/Yugoslavian α+
  α2 Cd132 T>G c.398T>G p.Val133Gly Caen Caucasian α+
  α2 Cd136 T>C c.410T>C p.Leu137Pro Bibba Caucasian α+
  1. Del; deletion, Dup; duplication, ins; insertion, Cd; codon, PA; poly(A)signal, term; termination codon, init; initiation codon
  2. * The duplicated α-globin genes, α1 and α2 on the short arm of chromosome 16, are named HBA1 and HBA2 respectively according to the HUGO nomenclature. For practical reasons there will be referred to them as α-genes in the text.