Skip to main content

Table 1 Primer sequences

From: Allele-specific differences in ryanodine receptor 1 mRNA expression levels may contribute to phenotypic variability in malignant hyperthermia

cDNA target Orientation Sequence (5'- > 3')
RYR 1 Fw. (AS1) CCATCCTGTCCTCTGTCAT CC
  Fw. (AS2) CCATCCTGTCCTCTGTCAT CT
  Rev. (common) GGTTCATCCTCATCCTCGCTCTTG
HPRT Fw. TCCAAAGATGGTCAAGGTCGC
  Rev. TTCAAATCCAACAAAGTCTGGCT
  1. Additional mismatches in the AS-PCR primer sequences are underlined.